Web supplement to
"A unique and universal molecular barcode array"

Sarah E. Pierce, Eula L. Fung, Daniel F. Jaramillo, Angela M. Chu, Ronald W. Davis, Corey E. Nislow, Guri N. Giaever

Nature Methods 3, 601 - 603 (2006)
doi:10.1038/nmeth905

Protocols

Pool construction:

Note: Hybridization to the tag array will identify any of those strains that are still underrepresented1. These strains can then be spiked in to the pools individually at the start of each experiment.

Pooled growth:

Heterozygous deletion pool:

Homozygous deletion pool:


Notes: Control samples should be generated as above, but using YPD for all growth steps in place of the selective condition.

For heterozygous profiling, cells are first recovered for 9 generations before being subjected to the condition of interest. This is to allow the cells to recover from freezing. The cells are then grown in the condition of interest and collected at 5, 10, 15 and 20 generations. Because heterozygous deletion phenotypes can be subtle, optimum results are usually obtained at the 20 generation time point. However, for further resolution, the earlier time points can be informative in ranking the strains. (If two strains are both completely absent from the final sample, their sensitivities can not be compared without earlier time points showing which strain dropped out of the pool faster, or individual growth curves).

For homozygous profiling, cells are not recovered in YPD before growth in the condition of interest. Because 15% of all homozygotes are slow-growing strains, a recovery phase would cause many strains to drop out of the pool before treatment even begins. The cells are grown in the condition of interest straight from the frozen stock and collected at 5, 10, 15 and 20 generations. Because heterozygous phenotypes are less subtle than homozygous phenotypes, optimum results are usually obtained at the 5 generation time point. Using an earlier time point also minimizes the condition-independent loss of slow-growing strains from the pool.

Although we use 125 cells/strain in order to minimize volume (and therefore compound consumption) it is preferable to use a greater number of cells/strain to reduce the sampling error when batch diluting. For example, using 1000 cells/strain yields a theoretical sampling error of ~3%.

Genomic DNA purification:

Purify genomic DNA from cells collected in during pooled growth. We use 1-2 O.D. of cells for each sample. Although any prep for genomic DNA can be used, we use Zymo Research YeaStar kit (catalog # D2002).

PCR Amplification of tags:

PCR Mix (100µl):

StockFinalVolume
H2O 55
PCR buffer 10x 1X 10
MgCl2 50 mM 2.5 mM 5
dNTPs 10 mM 0.2 mM 2
UP or DN mix50 µM 1 µM 2
Taq polymerase5 U/µl 5 U 1
Genomic DNA (~0.2µg) 25 µl

PCR Program:

  1. 94°C 3′
  2. 94°C 30″
  3. 55°C 30″
  4. 72°C 30″
  5. go to step 2 29X
  6. 72°C 3′
  7. 4°C

Primers:

NAME SEQUENCE
UPTAG 5' - GAT GTC CAC GAG GTC TCT - 3'
DNTAG 5' - CGG TGT CGG TCT CGT AG - 3'
BUPKANMX4 5' biotin- GTC GAC CTG CAG CGT ACG - 3'
BDNKANMX4 5' biotin- GAA AAC GAG CTC GAA TTC ATC G - 3'

UP mix = dissolve UPTAG and BUPTAGKANMX4 each in dH2O at 100 pm/µl, mix in a 1:1 ratio.
DN mix = dissolve DNTAG and BDNKANMX4 each in dH2O at 100 pm/µl, mix in a 1:1 ratio.

Array hybridization and scanning:

  • Set up a boiling water bath and a slushy ice bucket.
  • Fill the arrays (Affymetrix Genflex Tag 16K Array v2, Part No. 511331) with 90 µl 1x hybridization buffer.
  • Incubate at 42°C for at least 10 min with rotation at 20 rpm (we use an Affymetrix GeneArray Hybridization Oven 640) to pre-wet the array.
  • While arrays are equilibrating, add 20 µl of uptag PCR and 20 µl of downtag PCR to 60 µl of hybridization mix for a total volume of 100 µl in a 0.5 ml microfuge tube.
  • Boil each tube for 2 min and then set on ice for 2 min.
  • Spin tubes briefly to bring the samples to the bottom of the tubes.
  • Remove 1x hybridization buffer from each array.
  • Add the samples to the arrays.
  • Place a Tough Tag (Diversified Biotech, Inc., Boston, MA) over each gasket.
  • Hybridize for 3 -16 hrs at 42°C rotating at the array at 20 rpm.
  • Prime the fluidics station: put the tubings in place, empty the waste bottle, fill wash A, wash B, and water bottles, and run fluidics station protocol PRIME_450.
  • Prepare biotin labelling mix (do not freeze the mix).
  • Aliquot 600 µl biotin labelling mix per chip into tubes.
  • Remove tough-spots from chips.
  • Remove hybridization mix and fill chips with ~90 µl wash A.
  • Wrap chips that are waiting to be washed in aluminium foil.
  • Under Experiments: for each chip type in the sample name and the experiment name, enter the barcode.
  • Under Fluidics: enter the station, and which chip you will wash and label in which module using the "experiment" pull-down menu. Use the protocol "Genflex_TAG4_wash_protocol."
  • When the chips are ready, check for air bubbles and wash again if necessary before you engage the wash block.
  • Clean glass side of arrays with isopropanol and a cotton swab.
  • Put tough spots on the chips and put them in scanner.
  • Scan (we use an emission wavelength of 560 nm using an Affymetrix GeneArray Scanner).
  • When done with the fluidics, put all cablings in Millipore water and run SHUTDOWN_450.

Recipes:

2X Hybridization buffer (200mM MES, 2 M[Na+], 40 mM EDTA, 0.02% Tween 20):

  • 8.3 ml of 12X MES Stock
  • 17.7 ml of 5M NaCl
  • 4.0 ml of 0.5M EDTA
  • 0.1 ml of 10% Tween 20
  • 19.9 ml of H2O

Store at 4°C (shield from light)

12X MES stock (1.22M MES, 0.89 M[Na+]):

  • 0.70 g MES free acid monohydrate
  • 1.9 g MES Sodium Salt
  • 8 ml of H2O

Mix and adjust volume to 10 ml
The pH should be between 6.5 and 6.7
Filter through a 0.2 µm filter
Store at 4°C (shield from light)

Hybridization mix:

  • 75 µl 2X hybridization buffer
  • 0.5 µl B213 control oligonucleotide (100 fm/µl)
  • 12 µl of mixed oligonucleotides (12.5 pm/µl)
  • 3 µl 50X Denhardt's Solution (Sigma D-2532)

B213 control oligonucleotide:

The B213 oligonucleotide is a biotinylated control that hybridizes to the border of the microarray. Dissolve in dH2O at 100 fm/µl.

CTGAACGGTAGCATCTTGAC

Mixed oligonucleotides:

The mixed oligonucleotides consist of 8 primers: the 4 amplification primers and their complements, all unbiotinylated. Dissolve in dH2O at 100 pm/µl and mixed 1:1 for a final concentration of 12.5 pm/µl each. These primers help keep the PCR product single stranded by annealing to the common regions. Without these oligos, the sense and antisense strands from two different tags can hybridize by their common primer ends.

UptagGATGTCCACGAGGTCTCT
DntagCGGTGTCGGTCTCGTAG
UptagkanmxGTCGACCTGCAGCGTACG
DntagkanmxGAAAACGAGCTCGAATTCATCG
UptagcompCTACAGGTGCTCCAGAGA
DntagcompGCCACAGCCAGAGCATC
UpkancompCAGCTGGACGTCGCATGC
DnkancompCTTTTGCTCGAGCTTAAGTAGC

Wash A (6x SSPE-T):

  • 300 ml 20x SSPE
  • 1 ml 10% Tween
  • 699 ml H2O

Wash B (3x SSPE-T):

  • 150 ml 20x SSPE
  • 1 ml 10% Tween
  • 849 ml H2O

Biotin staining mix:

  • 51.4 µl w/ 20X SSPE
  • 3.4 µl 50X Denhardt's Solution
  • 1.7 µl 1% Tween 20
  • 0.29 µl 1 mg/ml streptavidin-phycoerythrin (Molecular Probes catalog #S-866)
  • 114 µl dH2O


References

  1. Deutschbauer, A.M. et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics (2005).
Inquiries can be addressed to sepierce@stanford.edu.